Select Page

snpIn a recent article, entitled “What Does it Mean to Have “The Gene” for Something? Not What You Think…“, I explained basic genetic variation. In summary, I talked about the fact that no one actually has “the gene for” some trait or disease, but instead they have the allele or variant necessary for that trait or disease.

This is an area of confusion for many because understanding it requires an understanding of how the genome works, and the workings of the genome are pretty complex.

To sum up that article:

  • Everyone has all the same genes. What differs and makes us unique is what “version” we have of that gene.
  • These “versions” are referred to as alleles or variants, but are sometimes called mutations. (“Mutation” can have multiple meanings as well, making this even more confusing. Here, “mutation” just means variant.).
  • If, for example, you study the gene for eye color, we all have an eye color gene, but we have different versions of that gene. If you have two “brown eye” alleles (one from each parent), you’ll have brown eyes. If you have two “blue eye” alleles, you’ll have blue eyes. If you have one of each, you’ll have brown eyes since brown eyed genes are dominant. (In actuality, eye color is the result of more than one gene, but it’s useful to illustrate the point).

So, in that last article, I used a VNTR (variable number of tandem repeats) as an example of different versions of one gene. However, today, much of the genotyping that’s done in research and used by 23andMe and similar companies focuses on SNPs (pronounced Snips), which stands for Single Nucleotide Polymorphisms.

 

Single Nucleotide Polymorphisms (SNPs)

To show you what a SNP looks like, let’s use the example of Gene D again:

ACGGTGCATGCACATG (Allele 1)

ACGGGGCATGCACATG (Allele 2)

This time, instead of the red representing a VNTR, it represents a SNP. The variation in the gene is due to ONE change in ONE nucleotide. That’s all it takes to produce a different result. So, if Gene D coded for eye color, you could say Allele 1 codes for brown eyes while Allele 2 codes for blue eyes.

When dealing with actual genetic data, where you have two copies of all genes (one from each parent), you would see something more like this:

Person #1

ACGGTGCATGCACATG
ACGGTGCATGCACATG

Person #2

ACGGGGCATGCACATG
ACGGGGCATGCACATG

For Gene D, Person #1 has the TT genotype for that SNP, while Person #2 has the GG genotype for that SNP. This is the sort of information you’ll get with your raw data from 23andMe.

In addition, most genes have multiple loci where variation occurs (i.e. multiple SNPs, VNTRs, etc). For example:

Person #2

ACGGGGCATGCACATGAATGGTTTACCTCTGA
ACGGGGCATGCACATGAATGGATTACCTCTGA

The genotype for SNP #1 is GG and the genotype for SNP #2 is TA. When you get on a site like 23andMe or LiveWello, they will tell you which variant you have at specific SNP locations in specific genes, and then cite research studies examining any traits or conditions associated with that particular variant.

This kind of genetic information is interesting, but it’s also a hotbed for misunderstanding and misinformation.┬áIn the next article, I explain more by offering an example with the so-called “Warrior Gene.”

 

Other Resources

Christie’s science fiction books

Christie’s science article archive

Pin It on Pinterest